celltracker red cmtpx dye (Thermo Fisher)
Structured Review
Celltracker Red Cmtpx Dye, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/celltracker+red+cmtpx/celltracker+green/pm40659786-680-16-26
Average 90 stars, based on 1 article reviews
Images
Related Articles
Co-Culture Assay:Article Title: Adventitial fibroblasts direct smooth muscle cell-state transition in pulmonary vascular disease Article Snippet: .. For PAAF–PASMC co- culture experiment, cells were fluorescently labeled with either CellTracker Green CMFDA (Thermo Scientific) or Labeling:Article Title: Adventitial fibroblasts direct smooth muscle cell-state transition in pulmonary vascular disease Article Snippet: .. For PAAF–PASMC co- culture experiment, cells were fluorescently labeled with either CellTracker Green CMFDA (Thermo Scientific) or Article Title: Adventitial fibroblasts direct smooth muscle cell-state transition in pulmonary vascular disease Article Snippet: .. For PAAF–PASMC co-culture experiment, cells were fluorescently labeled with either CellTracker Green CMFDA (Thermo Scientific) or Article Title: Aldehyde metabolism governs resilience of mucociliary clearance to air pollution exposure Article Snippet: .. For ROS and lipid peroxide labeling, isolated trachea tissues were incubated with LipiRADICAL Green (2.5 μM; Funakoshi), CellROX Deep Red (10 μM; Thermo Fisher Scientific), and Extraction:Article Title: Linking Metastatic Behavior and Metabolic Heterogeneity of Circulating Tumor Cells at Single-Cell Level Using an Integrative Microfluidic System. Article Snippet: Cross-sectional fluorescence images of the spheroids were captured using a Zeiss LSM780 inverted confocal laser scanning microscope at time points of 1, 2, 4, 8, and 24 h. The images were analyzed using ImageJ software. .. CTC Extraction: Following three PBS washes, Accutase cell digestion solution (Yeasen, USA) containing 10 μM Injection:Article Title: Linking Metastatic Behavior and Metabolic Heterogeneity of Circulating Tumor Cells at Single-Cell Level Using an Integrative Microfluidic System. Article Snippet: Cross-sectional fluorescence images of the spheroids were captured using a Zeiss LSM780 inverted confocal laser scanning microscope at time points of 1, 2, 4, 8, and 24 h. The images were analyzed using ImageJ software. .. CTC Extraction: Following three PBS washes, Accutase cell digestion solution (Yeasen, USA) containing 10 μM Article Title: Linking Metastatic Behavior and Metabolic Heterogeneity of Circulating Tumor Cells at Single‐Cell Level Using an Integrative Microfluidic System Article Snippet: Cross‐sectional fluorescence images of the spheroids were captured using a Zeiss LSM780 inverted confocal laser scanning microscope at time points of 1, 2, 4, 8, and 24 h. The images were analyzed using ImageJ software. .. Following three PBS washes, Accutase cell digestion solution (Yeasen, USA) containing 10 μM Incubation:Article Title: Linking Metastatic Behavior and Metabolic Heterogeneity of Circulating Tumor Cells at Single-Cell Level Using an Integrative Microfluidic System. Article Snippet: Cross-sectional fluorescence images of the spheroids were captured using a Zeiss LSM780 inverted confocal laser scanning microscope at time points of 1, 2, 4, 8, and 24 h. The images were analyzed using ImageJ software. .. CTC Extraction: Following three PBS washes, Accutase cell digestion solution (Yeasen, USA) containing 10 μM Article Title: Aldehyde metabolism governs resilience of mucociliary clearance to air pollution exposure Article Snippet: .. For ROS and lipid peroxide labeling, isolated trachea tissues were incubated with LipiRADICAL Green (2.5 μM; Funakoshi), CellROX Deep Red (10 μM; Thermo Fisher Scientific), and Article Title: Stiffening cells with light Article Snippet: Fluo-4, AM (ThermoFisher) was aliquoted at 1 mM in DMSO; final concentration during the 20-min incubation was 2 μM for microindentation and 6 μM for AFM experiments. .. Article Title: Linking Metastatic Behavior and Metabolic Heterogeneity of Circulating Tumor Cells at Single‐Cell Level Using an Integrative Microfluidic System Article Snippet: Cross‐sectional fluorescence images of the spheroids were captured using a Zeiss LSM780 inverted confocal laser scanning microscope at time points of 1, 2, 4, 8, and 24 h. The images were analyzed using ImageJ software. .. Following three PBS washes, Accutase cell digestion solution (Yeasen, USA) containing 10 μM other:Article Title: Coordinated differentiation of human intestinal organoids with functional enteric neurons and vasculature. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER iPSC 72.3 Cincinnati Children’s Hospital (McCracken et al.49) RVECs Weill Cornell Medicine (Palikuqi et al.28) Experimental models: Organisms/strains NOD-scid IL2Rg-null (NSG) mice Jackson Laboratory Strain#0005557 Oligonucleotides Primer: RN18S-forward GCAGAATCCACGCCAGTACAAG IDT N/A Primer: RN18S-reverse GCTTGTTGTCCAGACCATTGGC IDT N/A Primer: TAGLN-forward ACCCTCCATGGTCTTCAAGCAGAT IDT N/A Primer: TAGLN-reverse ATCTCCACGGTAGTGCCCATCATT IDT N/A Primer: CDH5-forward CATCTTCCCAGGAGGAACAG IDT N/A Primer: CDH5-reverse AGAGCTCCACTCACGCTCAG IDT N/A Primer: RET-forward CATTGGGCCTCTACTTCTCGRET IDT N/A Primer: RET-reverse GTGTCCTCCTGGATGCAGAT IDT N/A Primer: TUBB3-forward CCCAGTATGAGGGAGATCGT IDT N/A Primer: TUBB3-reverse CGATGCCATGCTCATCAC IDT N/A See Table S2 for all other primer sequences IDT N/A Software and algorithms Prism 9.4.1 GraphPad https://www.graphpad.com/ scientific-software/prism/ Adobe Photoshop 2023 Adobe https://www.adobe.com Adobe Illustrator 2023 Adobe https://www.adobe.com Scanpy (Wolf et al. 2018)46 https://github.com/theislab/scanpy Seurat (Satija et al. 2015)47 https://satijalab.org/seurat/ Python Python https://www.python.org/ R Studio Cran https://cran.rstudio.com/ Cellranger 103 https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/what-is-cell-ranger FlowJo BD https://www.flowjo.com/ ImageJ Schneider et al. (2012)48 https://imagej.nih.gov/ij/ Detailed methods and code for scRNAseq analysis GitHub https://github.com/jason-spence- lab/Childs_2023 Other Matrigel Corning Cat#354234 Isolation:Article Title: Aldehyde metabolism governs resilience of mucociliary clearance to air pollution exposure Article Snippet: .. For ROS and lipid peroxide labeling, isolated trachea tissues were incubated with LipiRADICAL Green (2.5 μM; Funakoshi), CellROX Deep Red (10 μM; Thermo Fisher Scientific), and Recombinant:Article Title: GRP78-CAR T cell effector function against solid and brain tumors is controlled by GRP78 expression on T cells Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD3 Miltenyi Biotec Cat#130-093-337 CD28 Miltenyi Biotec Cat#130-093-386 CD19-APC BD Biosciences Cat#555415 CD8-PerCP Biolegend Cat#344708 CD45RA-APC Biolegend Cat#304112 CCR7-FITC Biolegend Cat#353216 CD4-PE/Cy7 Biolegend Cat#344612 PD1-PE Biolegend Cat#329905 TIM3-PE/Cy7 Biolegend Cat#345013 LAG3-FITC Biolegend Cat#369307 HSPA5 Atlas antibodies Cat#HPA038845 Isotype Agilent DAKO Cat#X090302 Biological samples Human peripheral blood mononuclear cells (PBMCs) Deidentified healthy donors St. Jude Chemicals, peptides, and recombinant proteins rhIL-7 Peprotech Cat#200-7 rhIL-15 Peprotech Cat#200-15 rhFGF-b Peprotech Cat#100-18B rhEGF Peprotech Cat#AF-100-15 B27 Thermofisher Cat#12587010 N2 Thermofisher Cat#17502048 GeneJuice Novagen Cat#70967 Heparin Stemcell technologies Cat#7980 Lymphoprep Abbott Laboratories Cat#07811 Retronectin Clontech Cat#T100B Cas9 MacroLab N/A P3 Primary cell buffer Lonza Cat#V4XP-3032 Dasatinib LC Labs Cat#D-3307 LIVE/DEAD Aqua Fisher Scientific Cat#L34957 Concentration Assay:Article Title: Stiffening cells with light Article Snippet: Fluo-4, AM (ThermoFisher) was aliquoted at 1 mM in DMSO; final concentration during the 20-min incubation was 2 μM for microindentation and 6 μM for AFM experiments. .. |
