Review



celltracker red cmtpx dye  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher celltracker red cmtpx dye
    Celltracker Red Cmtpx Dye, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/celltracker+red+cmtpx/celltracker+green/pm40659786-680-16-26
    Average 90 stars, based on 1 article reviews
    celltracker red cmtpx dye - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Co-Culture Assay:

    Article Title: Adventitial fibroblasts direct smooth muscle cell-state transition in pulmonary vascular disease
    Article Snippet: .. For PAAF–PASMC co- culture experiment, cells were fluorescently labeled with either CellTracker Green CMFDA (Thermo Scientific) or CellTracker Red CMTPX (Thermo Scientific) for 30 min at 37°C. ..

    Labeling:

    Article Title: Adventitial fibroblasts direct smooth muscle cell-state transition in pulmonary vascular disease
    Article Snippet: .. For PAAF–PASMC co- culture experiment, cells were fluorescently labeled with either CellTracker Green CMFDA (Thermo Scientific) or CellTracker Red CMTPX (Thermo Scientific) for 30 min at 37°C. ..

    Article Title: Adventitial fibroblasts direct smooth muscle cell-state transition in pulmonary vascular disease
    Article Snippet: .. For PAAF–PASMC co-culture experiment, cells were fluorescently labeled with either CellTracker Green CMFDA (Thermo Scientific) or CellTracker Red CMTPX (Thermo Scientific) for 30 min at 37°C. ..

    Article Title: Aldehyde metabolism governs resilience of mucociliary clearance to air pollution exposure
    Article Snippet: .. For ROS and lipid peroxide labeling, isolated trachea tissues were incubated with LipiRADICAL Green (2.5 μM; Funakoshi), CellROX Deep Red (10 μM; Thermo Fisher Scientific), and CellTracker Red CMTPX (1:1,000 dilution; Thermo Fisher Scientific) in DMEM/F12 without phenol red (Thermo Fisher Scientific) for 30 minutes at 37°C. .. For acrolein labeling, trachea tissues were incubated with AcroleinRED (10 μM; Funakoshi) and CellMask Plasma Membrane Deep Red (1:1,000 dilution; Thermo Fisher Scientific) for 20 minutes at 37°C.

    Extraction:

    Article Title: Linking Metastatic Behavior and Metabolic Heterogeneity of Circulating Tumor Cells at Single-Cell Level Using an Integrative Microfluidic System.
    Article Snippet: Cross-sectional fluorescence images of the spheroids were captured using a Zeiss LSM780 inverted confocal laser scanning microscope at time points of 1, 2, 4, 8, and 24 h. The images were analyzed using ImageJ software. .. CTC Extraction: Following three PBS washes, Accutase cell digestion solution (Yeasen, USA) containing 10 μM CellTracker Red CMTPX (Thermo Fisher Scientific, USA) was injected via port 2, and the chip was incubated at 37 °C for 5 min. ..

    Injection:

    Article Title: Linking Metastatic Behavior and Metabolic Heterogeneity of Circulating Tumor Cells at Single-Cell Level Using an Integrative Microfluidic System.
    Article Snippet: Cross-sectional fluorescence images of the spheroids were captured using a Zeiss LSM780 inverted confocal laser scanning microscope at time points of 1, 2, 4, 8, and 24 h. The images were analyzed using ImageJ software. .. CTC Extraction: Following three PBS washes, Accutase cell digestion solution (Yeasen, USA) containing 10 μM CellTracker Red CMTPX (Thermo Fisher Scientific, USA) was injected via port 2, and the chip was incubated at 37 °C for 5 min. ..

    Article Title: Linking Metastatic Behavior and Metabolic Heterogeneity of Circulating Tumor Cells at Single‐Cell Level Using an Integrative Microfluidic System
    Article Snippet: Cross‐sectional fluorescence images of the spheroids were captured using a Zeiss LSM780 inverted confocal laser scanning microscope at time points of 1, 2, 4, 8, and 24 h. The images were analyzed using ImageJ software. .. Following three PBS washes, Accutase cell digestion solution (Yeasen, USA) containing 10 μM CellTracker Red CMTPX (Thermo Fisher Scientific, USA) was injected via port 2, and the chip was incubated at 37 °C for 5 min. ..

    Incubation:

    Article Title: Linking Metastatic Behavior and Metabolic Heterogeneity of Circulating Tumor Cells at Single-Cell Level Using an Integrative Microfluidic System.
    Article Snippet: Cross-sectional fluorescence images of the spheroids were captured using a Zeiss LSM780 inverted confocal laser scanning microscope at time points of 1, 2, 4, 8, and 24 h. The images were analyzed using ImageJ software. .. CTC Extraction: Following three PBS washes, Accutase cell digestion solution (Yeasen, USA) containing 10 μM CellTracker Red CMTPX (Thermo Fisher Scientific, USA) was injected via port 2, and the chip was incubated at 37 °C for 5 min. ..

    Article Title: Aldehyde metabolism governs resilience of mucociliary clearance to air pollution exposure
    Article Snippet: .. For ROS and lipid peroxide labeling, isolated trachea tissues were incubated with LipiRADICAL Green (2.5 μM; Funakoshi), CellROX Deep Red (10 μM; Thermo Fisher Scientific), and CellTracker Red CMTPX (1:1,000 dilution; Thermo Fisher Scientific) in DMEM/F12 without phenol red (Thermo Fisher Scientific) for 30 minutes at 37°C. .. For acrolein labeling, trachea tissues were incubated with AcroleinRED (10 μM; Funakoshi) and CellMask Plasma Membrane Deep Red (1:1,000 dilution; Thermo Fisher Scientific) for 20 minutes at 37°C.

    Article Title: Stiffening cells with light
    Article Snippet: Fluo-4, AM (ThermoFisher) was aliquoted at 1 mM in DMSO; final concentration during the 20-min incubation was 2 μM for microindentation and 6 μM for AFM experiments. .. CellTracker Red CMTPX (Invitrogen, ThermoFisher, ref. C34552) was used at a final concentration of 2mM during a 20-min incubation. ..

    Article Title: Linking Metastatic Behavior and Metabolic Heterogeneity of Circulating Tumor Cells at Single‐Cell Level Using an Integrative Microfluidic System
    Article Snippet: Cross‐sectional fluorescence images of the spheroids were captured using a Zeiss LSM780 inverted confocal laser scanning microscope at time points of 1, 2, 4, 8, and 24 h. The images were analyzed using ImageJ software. .. Following three PBS washes, Accutase cell digestion solution (Yeasen, USA) containing 10 μM CellTracker Red CMTPX (Thermo Fisher Scientific, USA) was injected via port 2, and the chip was incubated at 37 °C for 5 min. ..

    other:

    Article Title: Coordinated differentiation of human intestinal organoids with functional enteric neurons and vasculature.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER iPSC 72.3 Cincinnati Children’s Hospital (McCracken et al.49) RVECs Weill Cornell Medicine (Palikuqi et al.28) Experimental models: Organisms/strains NOD-scid IL2Rg-null (NSG) mice Jackson Laboratory Strain#0005557 Oligonucleotides Primer: RN18S-forward GCAGAATCCACGCCAGTACAAG IDT N/A Primer: RN18S-reverse GCTTGTTGTCCAGACCATTGGC IDT N/A Primer: TAGLN-forward ACCCTCCATGGTCTTCAAGCAGAT IDT N/A Primer: TAGLN-reverse ATCTCCACGGTAGTGCCCATCATT IDT N/A Primer: CDH5-forward CATCTTCCCAGGAGGAACAG IDT N/A Primer: CDH5-reverse AGAGCTCCACTCACGCTCAG IDT N/A Primer: RET-forward CATTGGGCCTCTACTTCTCGRET IDT N/A Primer: RET-reverse GTGTCCTCCTGGATGCAGAT IDT N/A Primer: TUBB3-forward CCCAGTATGAGGGAGATCGT IDT N/A Primer: TUBB3-reverse CGATGCCATGCTCATCAC IDT N/A See Table S2 for all other primer sequences IDT N/A Software and algorithms Prism 9.4.1 GraphPad https://www.graphpad.com/ scientific-software/prism/ Adobe Photoshop 2023 Adobe https://www.adobe.com Adobe Illustrator 2023 Adobe https://www.adobe.com Scanpy (Wolf et al. 2018)46 https://github.com/theislab/scanpy Seurat (Satija et al. 2015)47 https://satijalab.org/seurat/ Python Python https://www.python.org/ R Studio Cran https://cran.rstudio.com/ Cellranger 103 https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/what-is-cell-ranger FlowJo BD https://www.flowjo.com/ ImageJ Schneider et al. (2012)48 https://imagej.nih.gov/ij/ Detailed methods and code for scRNAseq analysis GitHub https://github.com/jason-spence- lab/Childs_2023 Other Matrigel Corning Cat#354234 Histo-Clear II National Diagnostics Cat#HS-202 UltraPure DNase/RNase-Free Distilled Water Thermo Fisher Cat#10977015 RNase Away Thermo Fisher Cat#700511 ProLong Gold Thermo Fisher Cat#P369300 TSA Plus Cyanine 3 (1:1500-2000) Akoya Biosciences Cat#NEL744001KT Mouse anti-VE-CAD R&D Systems Cat#MAB9381; RRID: AB_2260374 CellTracker Red CMTPX Thermo Fischer Cat#34552 CellTracker Deep Red Thermo Fischer Cat#34565 FluoSpheres Thermo Fischer Cat#F8829 Cell Stem Cell 32, 1–12.e1–e9, April 3, 2025 e3

    Isolation:

    Article Title: Aldehyde metabolism governs resilience of mucociliary clearance to air pollution exposure
    Article Snippet: .. For ROS and lipid peroxide labeling, isolated trachea tissues were incubated with LipiRADICAL Green (2.5 μM; Funakoshi), CellROX Deep Red (10 μM; Thermo Fisher Scientific), and CellTracker Red CMTPX (1:1,000 dilution; Thermo Fisher Scientific) in DMEM/F12 without phenol red (Thermo Fisher Scientific) for 30 minutes at 37°C. .. For acrolein labeling, trachea tissues were incubated with AcroleinRED (10 μM; Funakoshi) and CellMask Plasma Membrane Deep Red (1:1,000 dilution; Thermo Fisher Scientific) for 20 minutes at 37°C.

    Recombinant:

    Article Title: GRP78-CAR T cell effector function against solid and brain tumors is controlled by GRP78 expression on T cells
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD3 Miltenyi Biotec Cat#130-093-337 CD28 Miltenyi Biotec Cat#130-093-386 CD19-APC BD Biosciences Cat#555415 CD8-PerCP Biolegend Cat#344708 CD45RA-APC Biolegend Cat#304112 CCR7-FITC Biolegend Cat#353216 CD4-PE/Cy7 Biolegend Cat#344612 PD1-PE Biolegend Cat#329905 TIM3-PE/Cy7 Biolegend Cat#345013 LAG3-FITC Biolegend Cat#369307 HSPA5 Atlas antibodies Cat#HPA038845 Isotype Agilent DAKO Cat#X090302 Biological samples Human peripheral blood mononuclear cells (PBMCs) Deidentified healthy donors St. Jude Chemicals, peptides, and recombinant proteins rhIL-7 Peprotech Cat#200-7 rhIL-15 Peprotech Cat#200-15 rhFGF-b Peprotech Cat#100-18B rhEGF Peprotech Cat#AF-100-15 B27 Thermofisher Cat#12587010 N2 Thermofisher Cat#17502048 GeneJuice Novagen Cat#70967 Heparin Stemcell technologies Cat#7980 Lymphoprep Abbott Laboratories Cat#07811 Retronectin Clontech Cat#T100B Cas9 MacroLab N/A P3 Primary cell buffer Lonza Cat#V4XP-3032 Dasatinib LC Labs Cat#D-3307 LIVE/DEAD Aqua Fisher Scientific Cat#L34957 Celltracker Red CMTPX Invitrogen CatC34552 CAL520a.m. .. ATTbioquest Cat#21130 Celltrace Violet Thermofisher Cat#C34557 Matrigel Corning Cat#356234 Biotin-Ahx-CTVALPGGYVRVC Genscript N/A Critical commercial assays 13-plex human cytokine quantification kit Millipore Sigma Cat#HCYTOMAG-60K IFN-gamma ELISA R&D system Cat#SMIF00 CellTiter96 Aqueous One Solution Cell Proliferation Assay Promega Cat#G3580 MycoAlert Mycoplasma detection kit Lonza Cat#LT07-318 Rneasy Plus Mini Kit Qiagen Cat#74134 Tissue array Biomax Cat#FDA999w3 and FDA331 (Continued on next page) e1 Cell Reports Medicine 4, 101297, November 21, 2023

    Concentration Assay:

    Article Title: Stiffening cells with light
    Article Snippet: Fluo-4, AM (ThermoFisher) was aliquoted at 1 mM in DMSO; final concentration during the 20-min incubation was 2 μM for microindentation and 6 μM for AFM experiments. .. CellTracker Red CMTPX (Invitrogen, ThermoFisher, ref. C34552) was used at a final concentration of 2mM during a 20-min incubation. ..



    Similar Products

    94
    MedChemExpress cell tracker red cmtpx
    Cell Tracker Red Cmtpx, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/celltracker+red+cmtpx/CellTracker+Red+CMTPX/pm42055272-168-20-23
    Average 94 stars, based on 1 article reviews
    cell tracker red cmtpx - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    Thermo Fisher celltracker red cmtpx dye
    Celltracker Red Cmtpx Dye, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/celltracker+red+cmtpx/celltracker+green/pm40659786-680-16-26
    Average 90 stars, based on 1 article reviews
    celltracker red cmtpx dye - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    94
    MedChemExpress celltracker red
    Celltracker Red, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/celltracker+red+cmtpx/CellTracker+Red+CMTPX/pmc13056610-131-16-18
    Average 94 stars, based on 1 article reviews
    celltracker red - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    MedChemExpress adherent cells
    Adherent Cells, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/celltracker+red+cmtpx/CellTracker+Red+CMTPX/pmc13176526-297-0-12
    Average 94 stars, based on 1 article reviews
    adherent cells - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    MedChemExpress celltracker red cmtpx
    Celltracker Red Cmtpx, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/celltracker+red+cmtpx/CellTracker+Red+CMTPX/bio_rxiv__64898__2026__01__19__699861-223-0-10
    Average 94 stars, based on 1 article reviews
    celltracker red cmtpx - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    86
    Azenta sparse celltracker red cmtpx labeled cells
    (A) Experimental design for assessing S. aureus replication dynamics in MG63 osteoblastic cells. (B-K) MG63 cells, seeded at sparse density and labeled with <t>CellTracker</t> Red CMTPX (red), were infected at MOI 8 with S. aureus SH1000 expressing GFP (green) pre-labeled by eFluor-450 (blue). Following 2 hours of co-incubation, lysostaphin at 10 µg/mL was added to eliminate extracellular S. aureus . Time-lapse imaging was conducted over 24 hours with hourly acquisitions using automated confocal microscopy. (B-G) Representative confocal images and corresponding quantification of green (GFP) and blue (eFluor-450) fluorescence intensities over time. Images show single osteoblastic cells infected by: exclusively non-replicative S. aureus (B, C ), or at least one S. aureus transitioning from quiescence to slow replication (D, E) or fast replication leading to host cell lysis (F, G) (scale bar = 10 µm). (H) Hourly quantification of infected cells based on intracellular S. aureus replication dynamics (RD) across the 24-hour infection period. (I) Initiation and duration of the fast replicative phases. (J) Hourly quantification of infected cells experiencing either an ongoing or an ended fast replicative phase. (K) Global quantification of infected cells based on intracellular S. aureus replication dynamics over an infection period of 24 hours (ENR: Exclusively non-replicative; SR: slow replicative; FR: fast replicative). (H-K) Results were presented as mean ± SD (H, J, K) or median and quartiles (I) , representing 36 individual values (H, J, K) from 12 independent experiments ( H , K : N = 1005 infected cells, I , J : N = 474 infected cells). Mann-Whitney test: **** p < 0.0001.
    Sparse Celltracker Red Cmtpx Labeled Cells, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/celltracker+red+cmtpx/cells+celltracker+cmtpx+labeled+red+sparse/pmc12478902-282-13-21
    Average 86 stars, based on 1 article reviews
    sparse celltracker red cmtpx labeled cells - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    Thermo Fisher celltracker red cmtpx
    (A) Experimental design for assessing S. aureus replication dynamics in MG63 osteoblastic cells. (B-K) MG63 cells, seeded at sparse density and labeled with <t>CellTracker</t> Red CMTPX (red), were infected at MOI 8 with S. aureus SH1000 expressing GFP (green) pre-labeled by eFluor-450 (blue). Following 2 hours of co-incubation, lysostaphin at 10 µg/mL was added to eliminate extracellular S. aureus . Time-lapse imaging was conducted over 24 hours with hourly acquisitions using automated confocal microscopy. (B-G) Representative confocal images and corresponding quantification of green (GFP) and blue (eFluor-450) fluorescence intensities over time. Images show single osteoblastic cells infected by: exclusively non-replicative S. aureus (B, C ), or at least one S. aureus transitioning from quiescence to slow replication (D, E) or fast replication leading to host cell lysis (F, G) (scale bar = 10 µm). (H) Hourly quantification of infected cells based on intracellular S. aureus replication dynamics (RD) across the 24-hour infection period. (I) Initiation and duration of the fast replicative phases. (J) Hourly quantification of infected cells experiencing either an ongoing or an ended fast replicative phase. (K) Global quantification of infected cells based on intracellular S. aureus replication dynamics over an infection period of 24 hours (ENR: Exclusively non-replicative; SR: slow replicative; FR: fast replicative). (H-K) Results were presented as mean ± SD (H, J, K) or median and quartiles (I) , representing 36 individual values (H, J, K) from 12 independent experiments ( H , K : N = 1005 infected cells, I , J : N = 474 infected cells). Mann-Whitney test: **** p < 0.0001.
    Celltracker Red Cmtpx, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/celltracker+red+cmtpx/celltracker+green/pmc10694756__mmc2-418-115-118
    Average 90 stars, based on 1 article reviews
    celltracker red cmtpx - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    (A) Experimental design for assessing S. aureus replication dynamics in MG63 osteoblastic cells. (B-K) MG63 cells, seeded at sparse density and labeled with CellTracker Red CMTPX (red), were infected at MOI 8 with S. aureus SH1000 expressing GFP (green) pre-labeled by eFluor-450 (blue). Following 2 hours of co-incubation, lysostaphin at 10 µg/mL was added to eliminate extracellular S. aureus . Time-lapse imaging was conducted over 24 hours with hourly acquisitions using automated confocal microscopy. (B-G) Representative confocal images and corresponding quantification of green (GFP) and blue (eFluor-450) fluorescence intensities over time. Images show single osteoblastic cells infected by: exclusively non-replicative S. aureus (B, C ), or at least one S. aureus transitioning from quiescence to slow replication (D, E) or fast replication leading to host cell lysis (F, G) (scale bar = 10 µm). (H) Hourly quantification of infected cells based on intracellular S. aureus replication dynamics (RD) across the 24-hour infection period. (I) Initiation and duration of the fast replicative phases. (J) Hourly quantification of infected cells experiencing either an ongoing or an ended fast replicative phase. (K) Global quantification of infected cells based on intracellular S. aureus replication dynamics over an infection period of 24 hours (ENR: Exclusively non-replicative; SR: slow replicative; FR: fast replicative). (H-K) Results were presented as mean ± SD (H, J, K) or median and quartiles (I) , representing 36 individual values (H, J, K) from 12 independent experiments ( H , K : N = 1005 infected cells, I , J : N = 474 infected cells). Mann-Whitney test: **** p < 0.0001.

    Journal: PLOS Pathogens

    Article Title: Monitoring intracellular replication dynamics unveils high proportion of non-replicating antibiotic-tolerant Staphylococcus aureus inside osteoblasts

    doi: 10.1371/journal.ppat.1013525

    Figure Lengend Snippet: (A) Experimental design for assessing S. aureus replication dynamics in MG63 osteoblastic cells. (B-K) MG63 cells, seeded at sparse density and labeled with CellTracker Red CMTPX (red), were infected at MOI 8 with S. aureus SH1000 expressing GFP (green) pre-labeled by eFluor-450 (blue). Following 2 hours of co-incubation, lysostaphin at 10 µg/mL was added to eliminate extracellular S. aureus . Time-lapse imaging was conducted over 24 hours with hourly acquisitions using automated confocal microscopy. (B-G) Representative confocal images and corresponding quantification of green (GFP) and blue (eFluor-450) fluorescence intensities over time. Images show single osteoblastic cells infected by: exclusively non-replicative S. aureus (B, C ), or at least one S. aureus transitioning from quiescence to slow replication (D, E) or fast replication leading to host cell lysis (F, G) (scale bar = 10 µm). (H) Hourly quantification of infected cells based on intracellular S. aureus replication dynamics (RD) across the 24-hour infection period. (I) Initiation and duration of the fast replicative phases. (J) Hourly quantification of infected cells experiencing either an ongoing or an ended fast replicative phase. (K) Global quantification of infected cells based on intracellular S. aureus replication dynamics over an infection period of 24 hours (ENR: Exclusively non-replicative; SR: slow replicative; FR: fast replicative). (H-K) Results were presented as mean ± SD (H, J, K) or median and quartiles (I) , representing 36 individual values (H, J, K) from 12 independent experiments ( H , K : N = 1005 infected cells, I , J : N = 474 infected cells). Mann-Whitney test: **** p < 0.0001.

    Article Snippet: Infection was performed at MOI 8 (or 2 or 4 where indicated) using sparse CellTracker Red CMTPX-labeled cells in 24-well plates (4TITUDE, 4TI-0241) or 96-well plates (Greiner bio-one, 655090), as described above.

    Techniques: Labeling, Infection, Expressing, Incubation, Imaging, Confocal Microscopy, Fluorescence, Lysis, MANN-WHITNEY

    MG63 cells labeled (B , D) or not ( A , C , E ) with CellTracker Red CMTPX (red) were seeded at sparse (B , D) or confluent (A , C , E) density and infected and treated as previously described in (BJI035: rifampicin resistant). (A) At 2 hpi propidium iodide (PI) was added at 2 µg/mL. At 24 hpi PI fluorescence intensity was measured with a plate reader. PI fluorescence intensity is normalized to uninfected cells in untreated and rifampicin-treated conditions. (B) Time-lapse imaging was conducted over 24 hours with hourly acquisitions using automated confocal microscopy. Quantification of the S. aureus SH1000 population size per cell over time represented by the total green (GFP) pixel count normalized per cell. (C, E) Intracellular S. aureus SH1000 were collected at 1 hpi and 24 hpi, and the total number of S. aureus forming colonies on agar plate was investigated (C) as well as their area distribution frequency at 24 hpi (E) and the small colony variants rates (F) . (D) At 6 hpi, rifampicin treatment was either withdrawn by washing or maintained, and incubation continued. Time-lapse imaging was conducted over 18 hours post-withdrawal with hourly acquisitions using automated confocal microscopy. Quantification of infected cells based on intracellular S. aureus replication dynamics (RD). Results were presented either as single value and mean ± SD from 3 independent experiments (B, E) or as mean ± SD representing 9 individual values from 3 independent experiments (A , D : N = 165 infected cells, F) or 12 individual values from 4 independent experiments (C) . One-way ANOVA with Dunnett’s correction for multiple post hoc comparisons with the control (A) and Mann-Whitney test (C , D, F) : *p < 0.05, **p < 0.01, ****p < 0.0001.

    Journal: PLOS Pathogens

    Article Title: Monitoring intracellular replication dynamics unveils high proportion of non-replicating antibiotic-tolerant Staphylococcus aureus inside osteoblasts

    doi: 10.1371/journal.ppat.1013525

    Figure Lengend Snippet: MG63 cells labeled (B , D) or not ( A , C , E ) with CellTracker Red CMTPX (red) were seeded at sparse (B , D) or confluent (A , C , E) density and infected and treated as previously described in (BJI035: rifampicin resistant). (A) At 2 hpi propidium iodide (PI) was added at 2 µg/mL. At 24 hpi PI fluorescence intensity was measured with a plate reader. PI fluorescence intensity is normalized to uninfected cells in untreated and rifampicin-treated conditions. (B) Time-lapse imaging was conducted over 24 hours with hourly acquisitions using automated confocal microscopy. Quantification of the S. aureus SH1000 population size per cell over time represented by the total green (GFP) pixel count normalized per cell. (C, E) Intracellular S. aureus SH1000 were collected at 1 hpi and 24 hpi, and the total number of S. aureus forming colonies on agar plate was investigated (C) as well as their area distribution frequency at 24 hpi (E) and the small colony variants rates (F) . (D) At 6 hpi, rifampicin treatment was either withdrawn by washing or maintained, and incubation continued. Time-lapse imaging was conducted over 18 hours post-withdrawal with hourly acquisitions using automated confocal microscopy. Quantification of infected cells based on intracellular S. aureus replication dynamics (RD). Results were presented either as single value and mean ± SD from 3 independent experiments (B, E) or as mean ± SD representing 9 individual values from 3 independent experiments (A , D : N = 165 infected cells, F) or 12 individual values from 4 independent experiments (C) . One-way ANOVA with Dunnett’s correction for multiple post hoc comparisons with the control (A) and Mann-Whitney test (C , D, F) : *p < 0.05, **p < 0.01, ****p < 0.0001.

    Article Snippet: Infection was performed at MOI 8 (or 2 or 4 where indicated) using sparse CellTracker Red CMTPX-labeled cells in 24-well plates (4TITUDE, 4TI-0241) or 96-well plates (Greiner bio-one, 655090), as described above.

    Techniques: Labeling, Infection, Fluorescence, Imaging, Confocal Microscopy, Incubation, Control, MANN-WHITNEY

    MG63 cells labeled (A , C - G) or not (B) with CellTracker Red CMTPX (red) were seeded at sparse density and infected at MOI 8 with S. aureus SH1000 expressing GFP (green) pre-labeled by eFluor-450 (blue). Following 2 hours of co-incubation, lysostaphin at 10 µg/mL was added to eliminate extracellular S. aureus . Concomitantly, cells were treated with rifampicin at 6 µg/mL and/or ciprofloxacin at 2, 5, or 10 µg/mL or left untreated. Time-lapse imaging was conducted over 24 hours with hourly acquisitions using automated confocal microscopy (A , C - G) or intracellular S. aureus were collected at 1 hpi and 24 hpi, and total number of S. aureus forming colonies on agar plate was investigated (B) . (A , C) Quantification of infected cells based on intracellular S. aureus replication dynamics (RD) over an infection period of 24 hours. (B) Total number of intracellular S. aureus SH1000 forming colonies on plates. (D) Quantification of the S. aureus population size per cell over time represented by the total green (GFP) pixel count normalized per cell. Represent 1 experiment of 3 for easier readability. (E , F) Representative confocal images (E) and corresponding quantification of green (GFP) and blue (eFluor-450) fluorescence intensities over time (F) . Images show a single osteoblastic cell infected by S. aureus SH1000 experiencing an arrested fast replicative phase under ciprofloxacin treatment at 2 µg/mL (scale bar = 10 µm). (G) Quantification of the proportion of arrested fast replicative phases relative to the total fast replicative events measured. Results were presented either as mean ± SD representing 9 individual values from 3 independent experiments ( A : N = 1288, C : N = 745, G : N = 258 infected cells) or as 12 individual values from 4 independent experiments (B) . One-way ANOVA with Dunnett’s correction for multiple post hoc comparisons with the control (A , C , G) or Two-way ANOVA test with Sidak’s correction for multiple comparisons post hoc test ( B ; p < 0.05: treatment, p < 0.0001: time): * p < 0.05, ** p < 0.01, **** p < 0.0001.

    Journal: PLOS Pathogens

    Article Title: Monitoring intracellular replication dynamics unveils high proportion of non-replicating antibiotic-tolerant Staphylococcus aureus inside osteoblasts

    doi: 10.1371/journal.ppat.1013525

    Figure Lengend Snippet: MG63 cells labeled (A , C - G) or not (B) with CellTracker Red CMTPX (red) were seeded at sparse density and infected at MOI 8 with S. aureus SH1000 expressing GFP (green) pre-labeled by eFluor-450 (blue). Following 2 hours of co-incubation, lysostaphin at 10 µg/mL was added to eliminate extracellular S. aureus . Concomitantly, cells were treated with rifampicin at 6 µg/mL and/or ciprofloxacin at 2, 5, or 10 µg/mL or left untreated. Time-lapse imaging was conducted over 24 hours with hourly acquisitions using automated confocal microscopy (A , C - G) or intracellular S. aureus were collected at 1 hpi and 24 hpi, and total number of S. aureus forming colonies on agar plate was investigated (B) . (A , C) Quantification of infected cells based on intracellular S. aureus replication dynamics (RD) over an infection period of 24 hours. (B) Total number of intracellular S. aureus SH1000 forming colonies on plates. (D) Quantification of the S. aureus population size per cell over time represented by the total green (GFP) pixel count normalized per cell. Represent 1 experiment of 3 for easier readability. (E , F) Representative confocal images (E) and corresponding quantification of green (GFP) and blue (eFluor-450) fluorescence intensities over time (F) . Images show a single osteoblastic cell infected by S. aureus SH1000 experiencing an arrested fast replicative phase under ciprofloxacin treatment at 2 µg/mL (scale bar = 10 µm). (G) Quantification of the proportion of arrested fast replicative phases relative to the total fast replicative events measured. Results were presented either as mean ± SD representing 9 individual values from 3 independent experiments ( A : N = 1288, C : N = 745, G : N = 258 infected cells) or as 12 individual values from 4 independent experiments (B) . One-way ANOVA with Dunnett’s correction for multiple post hoc comparisons with the control (A , C , G) or Two-way ANOVA test with Sidak’s correction for multiple comparisons post hoc test ( B ; p < 0.05: treatment, p < 0.0001: time): * p < 0.05, ** p < 0.01, **** p < 0.0001.

    Article Snippet: Infection was performed at MOI 8 (or 2 or 4 where indicated) using sparse CellTracker Red CMTPX-labeled cells in 24-well plates (4TITUDE, 4TI-0241) or 96-well plates (Greiner bio-one, 655090), as described above.

    Techniques: Labeling, Infection, Expressing, Incubation, Imaging, Confocal Microscopy, Fluorescence, Control